View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4554_high_4 (Length: 323)
Name: NF4554_high_4
Description: NF4554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4554_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 39 - 314
Target Start/End: Original strand, 39396030 - 39396305
Alignment:
| Q |
39 |
tttagataatcaattcacttgaaatcaatttttaccactaacacacactaagtttgatgaaatcatggtggattctgggattcttttgaagctcgaagtg |
138 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39396030 |
tttagataatcaattcactcgaaatcaatttttaccactaacacacactaagtttgatgaaatcatggtggattctgggattcttttgaagctcgaagtg |
39396129 |
T |
|
| Q |
139 |
taatttttgctaaatttgcggcgacacattgcactaagtttgacgaaatcaatgtggtaattgagattttgttgaagtttcaaagtgcagttttttgcta |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39396130 |
taatttttgctaaatttgcggcgacacattgcactaagtttgacgaaatcaatgtggtaattgagattttgttgaagtttcaaagtgcagttttttgcta |
39396229 |
T |
|
| Q |
239 |
aaatcacggtggcacaacttaaatattccaaacacacaactccaatgtttggtattcctttctcacgtccctatgc |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39396230 |
aaatcacggtggcacaacttaaatattccaaacacactactccaatgtttggtattcctttctcacgtccctatgc |
39396305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 203 - 250
Target Start/End: Complemental strand, 17899511 - 17899465
Alignment:
| Q |
203 |
gattttgttgaagtttcaaagtgcagttttttgctaaaatcacggtgg |
250 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
17899511 |
gattttgttgaagtttcaaagtatag-tttttgctaaaatcacggtgg |
17899465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University