View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4554_high_5 (Length: 289)

Name: NF4554_high_5
Description: NF4554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4554_high_5
NF4554_high_5
[»] chr3 (1 HSPs)
chr3 (135-284)||(50307874-50308023)


Alignment Details
Target: chr3 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 135 - 284
Target Start/End: Complemental strand, 50308023 - 50307874
Alignment:
135 gcctcgataacttctccttcatttgttgaatcattcatttcttttttatcactctcattaatgttgccttcttcttggtttgtatccgtattttcatttt 234  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||    
50308023 gcctcgataacttctccttcatttgttgaatcattcatttcttttttatcactctcattaatgttcccttcttcttggtttgtatccgtattctcatttt 50307924  T
235 ggtcttgattatcttcatgttcatctttgttttgatcttcttttgctact 284  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||    
50307923 gatcttgattatcttcatgttcatctttgttttgatcttcttttgctact 50307874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University