View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4554_low_12 (Length: 222)
Name: NF4554_low_12
Description: NF4554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4554_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 50308343 - 50308134
Alignment:
| Q |
1 |
tctcacttcctaacacaaaaccaaatggaaattttgtatttcatttagtctggtgatcaataacagtttgaaatgcaccagccaatgctctcactttatt |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50308343 |
tctcacttcctaacacaaaaccaaaaggaaattttgtatttcatttagtctggtgatcgataacagtttgaaatgcaccagccaatgctctcactttatt |
50308244 |
T |
|
| Q |
101 |
ctttctctcttctcgtaacttgctagcagtttcttcaatcacatcattagatacttgagaagactctttcttcccttgcaccacgccactttcttcttcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
50308243 |
ctttctctcttctcgtaacttgctagcagtttcttcaatcacatcattagatacttgagaagattctttcttcccttgcaccacgccactttcttcttcc |
50308144 |
T |
|
| Q |
201 |
ttttcctttg |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
50308143 |
ttttcctttg |
50308134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University