View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4554_low_6 (Length: 289)
Name: NF4554_low_6
Description: NF4554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4554_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 135 - 284
Target Start/End: Complemental strand, 50308023 - 50307874
Alignment:
| Q |
135 |
gcctcgataacttctccttcatttgttgaatcattcatttcttttttatcactctcattaatgttgccttcttcttggtttgtatccgtattttcatttt |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
50308023 |
gcctcgataacttctccttcatttgttgaatcattcatttcttttttatcactctcattaatgttcccttcttcttggtttgtatccgtattctcatttt |
50307924 |
T |
 |
| Q |
235 |
ggtcttgattatcttcatgttcatctttgttttgatcttcttttgctact |
284 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50307923 |
gatcttgattatcttcatgttcatctttgttttgatcttcttttgctact |
50307874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University