View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4554_low_7 (Length: 261)
Name: NF4554_low_7
Description: NF4554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4554_low_7 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 43 - 261
Target Start/End: Original strand, 43376027 - 43376253
Alignment:
| Q |
43 |
atctgatctggtagggtgagttcgaaggtcaattatcaacgtggttaccttagaacacgtggcgttaagttaaagaaaaggtaaacagtgtcattcccgt |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43376027 |
atctgatctggtagggtgagttcgaaggtcaattgtcaacgtggttaccttagaacacgtggcgttaagttaaagaaaaggtaaacagtgtcattcccgt |
43376126 |
T |
|
| Q |
143 |
gtttttgacaactag--------gnnnnnnnnncaaattttattcgtttcgattttgcattacattaacgtagagaattctcaaaaacacatttgagtct |
234 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43376127 |
gtttttgacaactagaaaaaaaaaaaaaaaaaacaaattttattcgtttcgattttgcattacattaacgtagagaattctcaaaaacacatttgagtct |
43376226 |
T |
|
| Q |
235 |
atttcttgttttgtttcccacagagtt |
261 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43376227 |
atttcttgttttgtttcccacagagtt |
43376253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University