View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4554_low_9 (Length: 238)

Name: NF4554_low_9
Description: NF4554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4554_low_9
NF4554_low_9
[»] chr4 (2 HSPs)
chr4 (18-131)||(26574123-26574236)
chr4 (130-238)||(26573597-26573705)
[»] chr2 (18 HSPs)
chr2 (18-131)||(10370990-10371103)
chr2 (21-131)||(10334888-10334998)
chr2 (18-133)||(10340609-10340728)
chr2 (18-129)||(9287760-9287871)
chr2 (21-131)||(10346863-10346973)
chr2 (21-129)||(9285099-9285207)
chr2 (21-131)||(11425295-11425405)
chr2 (21-131)||(9318714-9318827)
chr2 (62-131)||(8574414-8574483)
chr2 (21-131)||(9291125-9291237)
chr2 (21-131)||(9273220-9273330)
chr2 (21-131)||(9271873-9271986)
chr2 (21-123)||(9326586-9326691)
chr2 (32-131)||(10351330-10351425)
chr2 (32-131)||(9068976-9069072)
chr2 (21-123)||(9315244-9315345)
chr2 (53-105)||(9062130-9062182)
chr2 (32-131)||(9076578-9076674)
[»] chr3 (1 HSPs)
chr3 (21-131)||(37461562-37461672)
[»] chr8 (1 HSPs)
chr8 (21-118)||(41968310-41968408)
[»] scaffold0667 (1 HSPs)
scaffold0667 (21-123)||(1726-1831)


Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 18 - 131
Target Start/End: Complemental strand, 26574236 - 26574123
Alignment:
18 tttttgtcccgagaatttaaattgagactgtaagcgatggacggaaggacctgtgaagtgcagctgaaacaggatgctccagttgtttcttgtgatggaa 117  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26574236 tttttgtccagagaatttaaattgagactgtaagcgatggacggaaggacctgtgaagtgcagctgaaacaggatgctccagttgtttcttgtgatggaa 26574137  T
118 ttagtcaccttggt 131  Q
    ||||||||||||||    
26574136 ttagtcaccttggt 26574123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 130 - 238
Target Start/End: Complemental strand, 26573705 - 26573597
Alignment:
130 gtattccatactgttttaaatgagatacctgttttgaaatgatcatgcaattatagtgnnnnnnnattttaaaatcattttgagccatatataagtatga 229  Q
    |||||||||||||||||||||||||||||||||||||||||||| | |||||||||||       |||||||||||||||| |||||||| |||||||||    
26573705 gtattccatactgttttaaatgagatacctgttttgaaatgatcgtacaattatagtgtttttttattttaaaatcatttttagccatatgtaagtatga 26573606  T
230 tacttttat 238  Q
    |||| ||||    
26573605 tactgttat 26573597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 94; Significance: 5e-46; HSPs: 18)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 18 - 131
Target Start/End: Complemental strand, 10371103 - 10370990
Alignment:
18 tttttgtcccgagaatttaaattgagactgtaagcgatggacggaaggacctgtgaagtgcagctgaaacaggatgctccagttgtttcttgtgatggaa 117  Q
    ||||||||||||| |||||||||||||||||||| |||||| ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||    
10371103 tttttgtcccgaggatttaaattgagactgtaagggatggaaggaagaacgtgtgaagtgcagctgaaacaggatgctccagttgtttcttgtgatggaa 10371004  T
118 ttagtcaccttggt 131  Q
    ||||||||||||||    
10371003 ttagtcaccttggt 10370990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 21 - 131
Target Start/End: Complemental strand, 10334998 - 10334888
Alignment:
21 ttgtcccgagaatttaaattgagactgtaagcgatggacggaaggacctgtgaagtgcagctgaaacaggatgctccagttgtttcttgtgatggaatta 120  Q
    |||||||||| |||||||||||||||||||| |||||| ||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||    
10334998 ttgtcccgaggatttaaattgagactgtaagggatggaaggaagaacgtgtgaagtgcagctgaaacaggatgctccagttgtttcttgtgatggaatta 10334899  T
121 gtcaccttggt 131  Q
    |||||||||||    
10334898 gtcaccttggt 10334888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 18 - 133
Target Start/End: Complemental strand, 10340728 - 10340609
Alignment:
18 tttttgtcccgagaatttaaattgagactgtaagcgatggacggaaggacctgtga----agtgcagctgaaacaggatgctccagttgtttcttgtgat 113  Q
    ||||||||||||| |||||||||||||||||||| |||||| ||||||||||||||    ||||||||||||||||||||||||||||||||||| ||||    
10340728 tttttgtcccgaggatttaaattgagactgtaagggatggaaggaaggacctgtgagtgaagtgcagctgaaacaggatgctccagttgtttcttatgat 10340629  T
114 ggaattagtcaccttggtat 133  Q
    |||||||||||||| |||||    
10340628 ggaattagtcacctcggtat 10340609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 18 - 129
Target Start/End: Complemental strand, 9287871 - 9287760
Alignment:
18 tttttgtcccgagaatttaaattgagactgtaagcgatggacggaaggacctgtgaagtgcagctgaaacaggatgctccagttgtttcttgtgatggaa 117  Q
    ||||||||||||| ||||||||||||| |||||| |||||| ||||| |||||||| |||||||||||||||||||||| |||||||||||||||||||     
9287871 tttttgtcccgaggatttaaattgagattgtaagggatggatggaagtacctgtgatgtgcagctgaaacaggatgctcaagttgtttcttgtgatggag 9287772  T
118 ttagtcaccttg 129  Q
    ||||||||||||    
9287771 ttagtcaccttg 9287760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 21 - 131
Target Start/End: Complemental strand, 10346973 - 10346863
Alignment:
21 ttgtcccgagaatttaaattgagactgtaagcgatggacggaaggacctgtgaagtgcagctgaaacaggatgctccagttgtttcttgtgatggaatta 120  Q
    |||||||||| ||||||||||||| |||||| |||||  ||||||||||||||||||||||||||||| || || || ||||||||||||||||||||||    
10346973 ttgtcccgaggatttaaattgagattgtaagggatggtaggaaggacctgtgaagtgcagctgaaacatgaagcaccggttgtttcttgtgatggaatta 10346874  T
121 gtcaccttggt 131  Q
    |||||||||||    
10346873 gtcaccttggt 10346863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 21 - 129
Target Start/End: Original strand, 9285099 - 9285207
Alignment:
21 ttgtcccgagaatttaaattgagactgtaagcgatggacggaaggacctgtgaagtgcagctgaaacaggatgctccagttgtttcttgtgatggaatta 120  Q
    |||||| ||| ||||||||||||| |||||| |||||| |||||||||||||| |||||||||||||| ||||||| ||| |||||||||||||||||||    
9285099 ttgtccggaggatttaaattgagattgtaagggatggaaggaaggacctgtgatgtgcagctgaaacatgatgctcaagtagtttcttgtgatggaatta 9285198  T
121 gtcaccttg 129  Q
    |||| ||||    
9285199 gtcatcttg 9285207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 21 - 131
Target Start/End: Original strand, 11425295 - 11425405
Alignment:
21 ttgtcccgagaatttaaattgagactgtaagcgatggacggaaggacctgtgaagtgcagctgaaacaggatgctccagttgtttcttgtgatggaatta 120  Q
    |||||||||| ||||||||||| | |||||| |||||| ||| |||||||||| |||||||||||||||||| ||| ||||||||||||||| |||||||    
11425295 ttgtcccgaggatttaaattgacattgtaagggatggaaggatggacctgtgatgtgcagctgaaacaggatactcgagttgtttcttgtgaaggaatta 11425394  T
121 gtcaccttggt 131  Q
     ||||||||||    
11425395 atcaccttggt 11425405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 21 - 131
Target Start/End: Complemental strand, 9318827 - 9318714
Alignment:
21 ttgtcccgagaatttaaattgagactgtaagcgatggacggaaggacctgtgaagt---gcagctgaaacaggatgctccagttgtttcttgtgatggaa 117  Q
    |||||||||| ||||||||||||| |||||| |||||| |||||||||||||| ||   |||||||||||||||| ||| ||||||||||||||||||||    
9318827 ttgtcccgaggatttaaattgagattgtaagggatggaaggaaggacctgtgatgtgcagcagctgaaacaggatactcaagttgtttcttgtgatggaa 9318728  T
118 ttagtcaccttggt 131  Q
    ||||  ||||||||    
9318727 ttagaaaccttggt 9318714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 62 - 131
Target Start/End: Original strand, 8574414 - 8574483
Alignment:
62 aaggacctgtgaagtgcagctgaaacaggatgctccagttgtttcttgtgatggaattagtcaccttggt 131  Q
    |||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
8574414 aaggacctgtgatgtgcagctgaaacaggatgctcaagttgtttcttgtgatggaattagtcaccttggt 8574483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 21 - 131
Target Start/End: Complemental strand, 9291237 - 9291125
Alignment:
21 ttgtcccgagaatttaaattgagactgtaagcgatggacggaaggacctgtgaagtgcagctgaaacaggatgctc--cagttgtttcttgtgatggaat 118  Q
    |||||||||| ||||||||||||| |||||| |||||| | |||| ||||||| |||||||||||||||||| |||   |||||||| ||||||||||||    
9291237 ttgtcccgaggatttaaattgagattgtaagggatggaagtaagggcctgtgatgtgcagctgaaacaggattctcaaaagttgtttgttgtgatggaat 9291138  T
119 tagtcaccttggt 131  Q
    |||| ||||||||    
9291137 tagttaccttggt 9291125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 21 - 131
Target Start/End: Complemental strand, 9273330 - 9273220
Alignment:
21 ttgtcccgagaatttaaattgagactgtaagcgatggacggaaggacctgtgaagtgcagctgaaacaggatgctccagttgtttcttgtgatggaatta 120  Q
    |||||||||| ||||||||||||| ||| || |||||| ||||||||||||||  |||||||  |||| ||||||| ||||| ||||||| |||||||||    
9273330 ttgtcccgaggatttaaattgagattgtgagggatggaaggaaggacctgtgatatgcagctttaacacgatgctcaagttgcttcttgttatggaatta 9273231  T
121 gtcaccttggt 131  Q
    ||| |||||||    
9273230 gtctccttggt 9273220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 21 - 131
Target Start/End: Complemental strand, 9271986 - 9271873
Alignment:
21 ttgtcccgagaatttaaattgagactgtaagcgatggacggaaggacctgtgaagtgcagctgaaacaggatgctcca---gttgtttcttgtgatggaa 117  Q
    |||||||||| ||||||||||||| |||||| ||||||  ||||||| ||||| ||||||||||||||||||  || |   |||||||||||| ||||||    
9271986 ttgtcccgaggatttaaattgagattgtaagggatggaaagaaggacatgtgatgtgcagctgaaacaggataatcaagttgttgtttcttgtaatggaa 9271887  T
118 ttagtcaccttggt 131  Q
    |||||| |||||||    
9271886 ttagtctccttggt 9271873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 21 - 123
Target Start/End: Complemental strand, 9326691 - 9326586
Alignment:
21 ttgtcccgagaatttaaattgagactgtaagcgatggacggaaggacctgtgaagtgcagc---tgaaacaggatgctccagttgtttcttgtgatggaa 117  Q
    |||||||||| ||||||||||||  |||||| ||| || |||||||||||||| |||||||   ||| ||||||| ||| ||||||||||||||||||||    
9326691 ttgtcccgaggatttaaattgaggttgtaagggatagaaggaaggacctgtgatgtgcagcagctgatacaggatactcaagttgtttcttgtgatggaa 9326592  T
118 ttagtc 123  Q
    ||||||    
9326591 ttagtc 9326586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 32 - 131
Target Start/End: Complemental strand, 10351425 - 10351330
Alignment:
32 atttaaattgagactgtaagcgatggacggaaggacctgtgaagtgcagctgaaacaggatgctccagttgtttcttgtgatggaattagtcaccttggt 131  Q
    ||||||||||||| ||||||    ||| ||||||||| ||||||||||||||||| |||||||| | |||||||||||||||||||||  ||||||||||    
10351425 atttaaattgagattgtaag----ggaaggaaggaccagtgaagtgcagctgaaataggatgcttctgttgtttcttgtgatggaattgctcaccttggt 10351330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 32 - 131
Target Start/End: Original strand, 9068976 - 9069072
Alignment:
32 atttaaattgagactgtaagcgatggacggaaggacctgtgaagtgc-agctgaaacaggatgctccagttgtttcttgtgatggaattagtcaccttgg 130  Q
    ||||||||||||| |||||| ||||||    ||||||||||| |||| | |||||||| ||||||| ||||| ||||||||||| |||||||||||||||    
9068976 atttaaattgagattgtaagggatgga----aggacctgtgatgtgccaactgaaacatgatgctcaagttgcttcttgtgatgtaattagtcaccttgg 9069071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 21 - 123
Target Start/End: Complemental strand, 9315345 - 9315244
Alignment:
21 ttgtcccgagaatttaaattgagactgtaagcgatggacggaaggacctgtgaagtg---cagctgaaacaggatgctccagttgtttcttgtgatggaa 117  Q
    |||||||||| ||||||||||||| |||||| |||||| |||    ||||||| |||   ||||||||||| ||||||| | ||||||||||||||||||    
9315345 ttgtcccgaggatttaaattgagattgtaagggatggaggga----cctgtgatgtgtagcagctgaaacatgatgctcaacttgtttcttgtgatggaa 9315250  T
118 ttagtc 123  Q
    ||||||    
9315249 ttagtc 9315244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 53 - 105
Target Start/End: Original strand, 9062130 - 9062182
Alignment:
53 gatggacggaaggacctgtgaagtgcagctgaaacaggatgctccagttgttt 105  Q
    |||||| |||||||||| ||| |||||||||||||| ||||||| ||||||||    
9062130 gatggaaggaaggacctatgatgtgcagctgaaacaagatgctcaagttgttt 9062182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 32 - 131
Target Start/End: Original strand, 9076578 - 9076674
Alignment:
32 atttaaattgagactgtaagcgatggacggaaggacctgtgaagtg-cagctgaaaca-ggatgctccagttgtttcttgtgatggaattagtcaccttg 129  Q
    ||||||||||||| ||||||    ||| |||||||||||||| ||| ||||||||| | |||||||  ||||||||||| ||||| ||||||||||||||    
9076578 atttaaattgagattgtaag----ggatggaaggacctgtgatgtgtcagctgaaagatggatgctagagttgtttctt-tgatgtaattagtcaccttg 9076672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 21 - 131
Target Start/End: Complemental strand, 37461672 - 37461562
Alignment:
21 ttgtcccgagaatttaaattgagactgtaagcgatggacggaaggacctgtgaagtgcagctgaaacaggatgctccagttgtttcttgtgatggaatta 120  Q
    |||||| ||| ||||||||||||| |||||| | |||| ||||| |||||| | |||||||||||||||| ||||| |||||||||||||||||||||||    
37461672 ttgtccggaggatttaaattgagattgtaaggggtggaaggaagaacctgtaatgtgcagctgaaacagggtgctcaagttgtttcttgtgatggaatta 37461573  T
121 gtcaccttggt 131  Q
    ||| |||||||    
37461572 gtctccttggt 37461562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 21 - 118
Target Start/End: Original strand, 41968310 - 41968408
Alignment:
21 ttgtcccgagaatttaaattgagactgtaagcgatggacggaaggacctgtgaagtgcagctgaaa-caggatgctccagttgtttcttgtgatggaat 118  Q
    ||||||| || ||||||||||||| |||||| |||||| |||||||||||||| |||||||||||| |||||||||| ||||||||||| |||||||||    
41968310 ttgtcccaaggatttaaattgagattgtaagggatggaaggaaggacctgtgatgtgcagctgaaaccaggatgctcaagttgtttcttctgatggaat 41968408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0667 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold0667
Description:

Target: scaffold0667; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 21 - 123
Target Start/End: Complemental strand, 1831 - 1726
Alignment:
21 ttgtcccgagaatttaaattgagactgtaagcgatggacggaaggacctgtgaagtgcagc---tgaaacaggatgctccagttgtttcttgtgatggaa 117  Q
    |||||| ||| ||||||||||||| |||||| | ||||  |||||| |||||| |||||||   |||||||| || ||| ||||||||||||| ||||||    
1831 ttgtccggaggatttaaattgagattgtaagggttggaatgaaggatctgtgatgtgcagcagctgaaacagaattctcaagttgtttcttgtaatggaa 1732  T
118 ttagtc 123  Q
    ||||||    
1731 ttagtc 1726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University