View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4556_high_5 (Length: 228)
Name: NF4556_high_5
Description: NF4556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4556_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 15 - 210
Target Start/End: Original strand, 30289256 - 30289451
Alignment:
| Q |
15 |
catagggaatcaatttccatgaagggatatgcatgtatgatgagattacgtaaatgcttgattgagtaatccataagcacctatgttcaaaaatgattag |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30289256 |
catagggaatcaatttccatgaagggataggcatgtatgatgagattacgtaaatgcttgattgagtaatccataagcacctatgttcaaaaatgattag |
30289355 |
T |
|
| Q |
115 |
aagtttcaaataaccttaccttaaatgacgattctcttatttcttgcaatcannnnnnngtgttttaaagatgtcatatgaaatgcatggagtttt |
210 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30289356 |
aagtttcaaacaaccttaccttaaatgacgattctcttatttcttgtcatcatttttttgtgttttaaagatgtcatatgaaatgcatggagtttt |
30289451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University