View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4557_low_5 (Length: 209)
Name: NF4557_low_5
Description: NF4557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4557_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 5e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 51234559 - 51234688
Alignment:
| Q |
1 |
agtgactattactacttccatgagcaaataaaaataagatatcaaaatggtaacaaagtctttaatcctaatatgtgtatcattgacttgtgagtgtgtt |
100 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
51234559 |
agtgactattaccagttccatgagcaaataaaaataagatatcaaaatggtaacaaagtctttaatcctaatatgtgtatcattgacttgttactgtgtt |
51234658 |
T |
|
| Q |
101 |
tgacataatcactcatgtgattagtgatta |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
51234659 |
tgacataatcactcatgtgattagtgatta |
51234688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 128 - 192
Target Start/End: Original strand, 51234994 - 51235058
Alignment:
| Q |
128 |
ttatctatcaatctcctttgtacatgttgatacttgtgtatcatttaggttctatgtgttcatct |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51234994 |
ttatctatcaatctcctttgtacatgttgatacttgtgtatcatttaggttctatgtgttcatct |
51235058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University