View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4558-Insertion-9 (Length: 165)
Name: NF4558-Insertion-9
Description: NF4558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4558-Insertion-9 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 2e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 2e-84
Query Start/End: Original strand, 4 - 165
Target Start/End: Complemental strand, 4662316 - 4662155
Alignment:
| Q |
4 |
aacagatttcacataatatacataagcctcgaattgcaaatttcttcttctgagcactccaaataccacaaactaaagttactccacacacgactcattt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4662316 |
aacagatttcacataatatacataagcctcgaattgcaaatttcttcttctgagcactccaaataccacaaactaaagttactccacacacgactcattt |
4662217 |
T |
 |
| Q |
104 |
aaagttgaagtaataatcagacaaaatctgcattgcaaccacaaacatgagacatttaaaat |
165 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4662216 |
aaggttgaagtaataatcagacaaaatctgcattgcaaccacaaacatgagacatttaaaat |
4662155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University