View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4558_high_1 (Length: 249)
Name: NF4558_high_1
Description: NF4558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4558_high_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 21 - 238
Target Start/End: Complemental strand, 31943994 - 31943775
Alignment:
| Q |
21 |
tgttgaatgtttgctgttttaggatttatttctatgattgcatgttgaaaattcggtgtttatgttattttgtttgattt-atgttgaaagnnnnnnnnn |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31943994 |
tgttgaatgtttgctgttttaggatttatttctatgattacatgttgaaaattcggtgtttatgttattttgtttgattttatgttgaaagttttttttt |
31943895 |
T |
 |
| Q |
120 |
nnn-agggtttatttcttcacatgttgaaaattttgttttcagggtttatttcttcatgttggaaattatattttaattgacatgatttcatgctgaaaa |
218 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31943894 |
ttttagggtttatttcttcatatgttgaaaattttgttttcagggtttatttcttcatgttggaaattatattttaattgacatgatttcttgctgaaaa |
31943795 |
T |
 |
| Q |
219 |
ttgtttgttttatggttcat |
238 |
Q |
| |
|
|||| ||||||||||||||| |
|
|
| T |
31943794 |
ttgtgtgttttatggttcat |
31943775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 140 - 238
Target Start/End: Complemental strand, 1341981 - 1341881
Alignment:
| Q |
140 |
atgttgaaaattttgttttc-agggtttatttcttcatgttggaaattatattttaatt-gacatgatttcatgctgaaaattgtttgttttatggttca |
237 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||| |||||||||||| ||||| || ||||||||||| |||| |||||||| |||||||||||||| |
|
|
| T |
1341981 |
atgttcaaaattttgttttttagggtttatttcttcttgttggaaattaaatttttctttgacatgatttcttgcttaaaattgtgtgttttatggttca |
1341882 |
T |
 |
| Q |
238 |
t |
238 |
Q |
| |
|
| |
|
|
| T |
1341881 |
t |
1341881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 21 - 100
Target Start/End: Complemental strand, 1342061 - 1341983
Alignment:
| Q |
21 |
tgttgaatgtttgctgttttaggatttatttctatgattgcatgttgaaaattcggtgt-ttatgttattttgtttgattt |
100 |
Q |
| |
|
||||||| |||| ||||||||| ||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
1342061 |
tgttgaaattttggtgttttagggtttatttctttgattgcatgttgaaaatt--gtgtattatgttattttgtttgattt |
1341983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 109
Target Start/End: Complemental strand, 9394534 - 9394445
Alignment:
| Q |
21 |
tgttgaatgtttgctgttttaggatttatttctatgattgcatgttgaaaattcggtgtttatgttattttgtttga-tttatgttgaaa |
109 |
Q |
| |
|
||||||| |||| ||||||||| ||||||||| ||||| ||||||| || | || ||||||||||||||||||| |||||||||||| |
|
|
| T |
9394534 |
tgttgaaaatttgatgttttagggtttatttctttgatttcatgttggcaactgtgtttttatgttattttgtttgattttatgttgaaa |
9394445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University