View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4559-Insertion-7 (Length: 160)
Name: NF4559-Insertion-7
Description: NF4559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4559-Insertion-7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 8 - 148
Target Start/End: Original strand, 40750981 - 40751121
Alignment:
| Q |
8 |
aaagatagatatatctgcaaccacttttgttcttaattagtgaaatcataaaggatcaaagttgctatatattacacagaaacaagaaatttcaatgaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40750981 |
aaagatagatatatctgcaaccacttttgttcttaattagtgaaatcataaaggatcaaagttgctatatattacatagaaacaagaaatttcaatgaat |
40751080 |
T |
|
| Q |
108 |
gtttgcaaattttcaatataccttacttattcatagagaat |
148 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40751081 |
gtctgcaaattttcaatataccttacttattcatagagaat |
40751121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University