View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4559-Insertion-9 (Length: 119)
Name: NF4559-Insertion-9
Description: NF4559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4559-Insertion-9 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 4e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 4e-57
Query Start/End: Original strand, 8 - 119
Target Start/End: Complemental strand, 43106951 - 43106840
Alignment:
| Q |
8 |
cccgctaccccgaaatccgagtcgacacagctcaacttacctccctcattgtcaccagcaaccagcagtacctcactgcaaaatgggacatcacattcat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43106951 |
cccgctaccccgaaatccgagtcgacacagctcaacttacctccctcattgtcaccagcaaccagcagtacctcactgcaaaatgggacatcacattcat |
43106852 |
T |
|
| Q |
108 |
tgcctcaaaccc |
119 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43106851 |
tgcctcaaaccc |
43106840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 79 - 119
Target Start/End: Complemental strand, 43099666 - 43099626
Alignment:
| Q |
79 |
ctcactgcaaaatgggacatcacattcattgcctcaaaccc |
119 |
Q |
| |
|
|||| ||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
43099666 |
ctcaatgcaaaatgggacatcacactcattgtctcaaaccc |
43099626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University