View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4559_high_28 (Length: 241)
Name: NF4559_high_28
Description: NF4559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4559_high_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 14 - 234
Target Start/End: Complemental strand, 6249394 - 6249181
Alignment:
| Q |
14 |
aaagacaacacccctgatcctatcacagctgttattatgtgtgaacttgcagtcaaaacacttcc-tgcatatcatttcaattaatcaagccagttataa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6249394 |
aaagacaacacccctgatcctatcacagctgttattatgtgtgaaattgcagtcaaaacacttccatgcatatcatttcaattaatcaagccagttataa |
6249295 |
T |
|
| Q |
113 |
aaatacattgattatatcatatttagtaacatatctaaaagaactatgatgtagtgaccaatttaacgattgatttagagacgagaatgttaaatcgatc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
6249294 |
aaatacattgattatatcatatttagtaacatatctaaaagaactatgatgtagtgaccaattt--------atttagagacaagaatgttaaatcgatc |
6249203 |
T |
|
| Q |
213 |
gcttacattatccacctatgct |
234 |
Q |
| |
|
|||||||||||| ||| ||||| |
|
|
| T |
6249202 |
gcttacattatcaaccgatgct |
6249181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 14 - 85
Target Start/End: Original strand, 39429214 - 39429285
Alignment:
| Q |
14 |
aaagacaacacccctgatcctatcacagctgttattatgtgtgaacttgcagtcaaaacacttcctgcatat |
85 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||| ||||| ||| ||||||||||||||||| |
|
|
| T |
39429214 |
aaagacaacacccctgatcctataacagctgttataatgtgtgagcttgcggtccaaacacttcctgcatat |
39429285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 54
Target Start/End: Original strand, 44324966 - 44324998
Alignment:
| Q |
22 |
cacccctgatcctatcacagctgttattatgtg |
54 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
44324966 |
caccccagatcctatcacagctgttattatgtg |
44324998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 68
Target Start/End: Original strand, 51719910 - 51719958
Alignment:
| Q |
20 |
aacacccctgatcctatcacagctgttattatgtgtgaacttgcagtca |
68 |
Q |
| |
|
||||| |||||||||||||| |||||||| || |||| ||||||||||| |
|
|
| T |
51719910 |
aacactcctgatcctatcactgctgttatgatatgtgcacttgcagtca |
51719958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University