View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4559_high_29 (Length: 240)
Name: NF4559_high_29
Description: NF4559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4559_high_29 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 21 - 240
Target Start/End: Original strand, 44646014 - 44646234
Alignment:
| Q |
21 |
tagacggttacagaatacagactatgtaaccttcgagcgatattcaataggaaagaaggtttcagatttactggcttgttgtgagcacacttccctcatg |
120 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44646014 |
tagacggttacagaatacggactatgtaaccttcgagcgatattcaataggaaagaaggtttcagatttactggcttgttgtgagcacacttccctcatg |
44646113 |
T |
 |
| Q |
121 |
agtgggt-gtctgaatagcttagttttggggctaaagaaatataaaggttcgaacaaagaatgacaagttcagttgcaagcgctttagagagaggtcgat |
219 |
Q |
| |
|
||||||| ||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44646114 |
agtgggtagtccgaatagcttaattttggggctaaagaaatataaaggttcgaacaaagaatgacaagttcagttgcaagcgctttagagagaggtcgat |
44646213 |
T |
 |
| Q |
220 |
gcttattttgaaagaaccctt |
240 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
44646214 |
gcttattttgaaagaaccctt |
44646234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University