View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4559_low_21 (Length: 277)
Name: NF4559_low_21
Description: NF4559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4559_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 14 - 269
Target Start/End: Original strand, 34330732 - 34330987
Alignment:
| Q |
14 |
gatgttatattagtttagtatacttgtaactagaaaagctgagttcagatgaaattgaaatgaatctgagaaaactactaggttgtgttgttggttgctt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34330732 |
gatgttatattagtttagtatacttgtaactagaaaagctgagttcagatgaaattgaaatgaatctgagaaaactactaggttgtgttgttggttgctt |
34330831 |
T |
 |
| Q |
114 |
atgaaattccttttgctttcatatatatgtgtttcaggtctgtgtaccaatttgtcctgtcaccaattataaagctgttgaaaccaaacatgtcatattc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34330832 |
atgaaattccttttgctttcatatatatgtgtttcaggtctgtgtaccaatttgtcctgtcaccaattataaagctgttgaaaccaaacatgtcatattc |
34330931 |
T |
 |
| Q |
214 |
tctttaccctaccttttttccttactcttcaatgaaacaaattcccagcctatgat |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34330932 |
tctttaccctaccttttttccttactcttcaatgaaacaaattcccagccaatgat |
34330987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University