View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4560-Insertion-3 (Length: 303)
Name: NF4560-Insertion-3
Description: NF4560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4560-Insertion-3 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 8 - 303
Target Start/End: Complemental strand, 54978313 - 54978015
Alignment:
| Q |
8 |
tcatcacgcatcaattcagagtcacaaccccaaatagcacatctagaactttttgccccggccatatgtggatgcttgtccaaaccgttactcaactttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
54978313 |
tcatcacgcatcaattcagagtcacaaccccaaatagcacatctagaactttttgccccggccatatgtggatggttgtccaaaccgttactcaactttc |
54978214 |
T |
|
| Q |
108 |
tacgcttatggttg---tcgaatctttctggcgaatccattggttggttatcaggagttggtggtgtccacactgtataattctccgccaaatcatcatc |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54978213 |
tacgcttatggttgcagtcgaatctttctggcgaatccattggttggttatcaggagttggtggtgtccacactgtataattctccgccaaatcatcatc |
54978114 |
T |
|
| Q |
205 |
aattcgtagcttgcaatcaaaaacttcttcaattattggatactccaaaggaggattatgtgcttcagacgcatcagaagtgtctggcacatttactga |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54978113 |
aattcgtagcttgcaatcaaaaacttcttcaattattggatactccaaaggaggattatgtgcttcagacgcatcagaagtgtctggcacatttactga |
54978015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University