View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4561-Insertion-10 (Length: 265)
Name: NF4561-Insertion-10
Description: NF4561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4561-Insertion-10 |
 | |
|
| [»] chr6 (3 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 223; Significance: 1e-123; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 43 - 265
Target Start/End: Original strand, 5692601 - 5692823
Alignment:
| Q |
43 |
attgcaaaatggggcaaagttagaggacaaaaatgttgttttattaatcgggggcaaaattataattttaacaaatttagggaaccaaaaatgagtttaa |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5692601 |
attgcaaaatggggcaaagttagaggacaaaaatgttgttttattaatcgggggcaaaattataattttaacaaatttagggaaccaaaaatgagtttaa |
5692700 |
T |
|
| Q |
143 |
gcctctgaatgattgcaatagttgaatgaaactacctgaaatttggaactacaaagccagcaagcccagcaacctcactaagcgcgtctctccatttcag |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5692701 |
gcctctgaatgattgcaatagttgaatgaaactacctgaaatttggaactacaaagccagcaagcccagcaacctcactaagcgcgtctctccatttcag |
5692800 |
T |
|
| Q |
243 |
cgacttgtctgtcttctttgaaa |
265 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5692801 |
cgacttgtctgtcttctttgaaa |
5692823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 163 - 242
Target Start/End: Complemental strand, 5276264 - 5276185
Alignment:
| Q |
163 |
gttgaatgaaactacctgaaatttggaactacaaagccagcaagcccagcaacctcactaagcgcgtctctccatttcag |
242 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||| | |||||||||||| ||| || |||||||||||||| |
|
|
| T |
5276264 |
gttgaattaaattacctgaaatttggaactacaaagccagcaatctcagcaacctcacgaagtgcatctctccatttcag |
5276185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 195 - 265
Target Start/End: Complemental strand, 5174417 - 5174347
Alignment:
| Q |
195 |
aaagccagcaagcccagcaacctcactaagcgcgtctctccatttcagcgacttgtctgtcttctttgaaa |
265 |
Q |
| |
|
||||||||||||| ||||| |||||| ||| || |||||||||||||| ||| || | |||||||||||| |
|
|
| T |
5174417 |
aaagccagcaagctcagcagcctcacgaagtgcatctctccatttcagggacgtgcttttcttctttgaaa |
5174347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University