View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4561-Insertion-7 (Length: 428)
Name: NF4561-Insertion-7
Description: NF4561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4561-Insertion-7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-134; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 8 - 250
Target Start/End: Original strand, 14103873 - 14104115
Alignment:
| Q |
8 |
ccaaacaattcaacatgttaggaatttacatgcaacgttcatggatcgttcttttcatcacaggaattctccttttacctcttttcatctttgcaacacc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14103873 |
ccaaacaattcaacatgttaggaatttacatgcaacgttcatggatcgttcttttcatcacaggaattctccttttacctcttttcatctttgcaacacc |
14103972 |
T |
|
| Q |
108 |
aatcttaaacttttttggacaaccacaagagatatctgagctagctggagtgatttcaatgtggctaataccaactcacgtgacttatgcattctttttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14103973 |
aatcttaaacttttttggacaaccacaagagatatctgagctagctggagtgatttcaatgtggctaataccaactcacgtgacttatgcattctttttt |
14104072 |
T |
|
| Q |
208 |
cctctttatttcttcttgcaaagtcagctcaagaataacatca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14104073 |
cctctttatttcttcttgcaaagtcagctcaagaataacatca |
14104115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 313 - 428
Target Start/End: Original strand, 14104178 - 14104293
Alignment:
| Q |
313 |
aagtttaagcttggtgttattgctcttgttgcttctgggaatgtggcttggattgttttggtgtttggnnnnnnngggtatgctgttttgggtggttgtc |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
14104178 |
aagtttaagcttggtgttattgctcttgttgcttctgggaatgtggcttggattgttttggtgtttggtttttttgggtatgctgttttgtgtggttgtc |
14104277 |
T |
|
| Q |
413 |
ccttaacttggactgg |
428 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
14104278 |
ccttaacttggactgg |
14104293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University