View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4561_high_7 (Length: 238)
Name: NF4561_high_7
Description: NF4561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4561_high_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 10497900 - 10497684
Alignment:
| Q |
1 |
aaattaactttaaaagaatatgatttaattacctatgaaagaatgcaaccgtggtaacggttagagcagagttcaacttgaggtacccatcccaaagctt |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10497900 |
aaattaactttaaaagaagatgatttaattacctatgaaagaatgcaaccgtggtaacggttagagcagagttcaacttgaggtacccatcccaaagctt |
10497801 |
T |
|
| Q |
101 |
attagatattagacttgttttctgctttttataagcagccatgcctaaactttgactttcaaatttggtggtcatattcattgttgacatctgaaaaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10497800 |
attagatattagacttgttttctgctttttattagcagccatggctaaactttgactttcaaatttggtggtcatattcattgttgacatctga-aaaag |
10497702 |
T |
|
| Q |
201 |
aataaatcaaagataaag |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
10497701 |
aataaatcaaagataaag |
10497684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University