View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4561_low_4 (Length: 275)

Name: NF4561_low_4
Description: NF4561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4561_low_4
NF4561_low_4
[»] chr1 (2 HSPs)
chr1 (129-194)||(49059625-49059690)
chr1 (18-89)||(49059509-49059580)
[»] scaffold0121 (1 HSPs)
scaffold0121 (210-238)||(33528-33556)


Alignment Details
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 129 - 194
Target Start/End: Original strand, 49059625 - 49059690
Alignment:
129 gttatgtgatcctttcctccaaattaattattctttcttgcaatatcaataataatttatttttat 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49059625 gttatgtgatcctttcctccaaattaattattctttcttgcaatatcaataataatttatttttat 49059690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 18 - 89
Target Start/End: Original strand, 49059509 - 49059580
Alignment:
18 aaatgtttgttaaagagtgaaccagacaagataatgtaatttgtctttataacctatacgattgctttgatg 89  Q
    ||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
49059509 aaatgtttggtaaagagtgaaccagacatgataatgtaatttgtctttataacctatacgattgctttgatg 49059580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0121 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0121
Description:

Target: scaffold0121; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 210 - 238
Target Start/End: Original strand, 33528 - 33556
Alignment:
210 gcttaaatgtgttttttgtctatctattt 238  Q
    |||||||||||||||||||||||||||||    
33528 gcttaaatgtgttttttgtctatctattt 33556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University