View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4562_low_13 (Length: 363)
Name: NF4562_low_13
Description: NF4562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4562_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 21 - 353
Target Start/End: Complemental strand, 15067894 - 15067562
Alignment:
| Q |
21 |
gtcgccgtagaaccacgttcgacttacgaatgggtcagtcaccttcgctcccaaacccaatcctcctccaccttccaccaggccatctccacatacacca |
120 |
Q |
| |
|
||||||| ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15067894 |
gtcgccgcagaaccacgtttaccttccgaatgggtcagtcaccttcgctcccaaacccaatcctcctccaccttccaccaggccatctccacatacacca |
15067795 |
T |
 |
| Q |
121 |
acatggtcaccgccggcgtccctcctgacaatttcgctttccccgccgtcctcaaagcaaccgccggcatccaagaccttaacctcggcaaacaactcca |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15067794 |
acatggtcaccgccggcgtccctcctgacaatttcgctttccccgccgtcctcaaagcaaccgccggcatccaagaccttaacctcggcaaacaactcca |
15067695 |
T |
 |
| Q |
221 |
tgcccatgtcttcaaattcggacaagctctccctactgctgtccctaactccctcgttaacatgtacggtaaatgcggtgatatcgacgctgcacgccgt |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15067694 |
tgcccatgtcttcaaattcggacaagctctccctactgctgtccctaactccttcgttaacatgtacggtaaatgcggtgatatcgacgctgcacgccgt |
15067595 |
T |
 |
| Q |
321 |
gtgtttgatgaaataaccaaccgtgatgatgtc |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
15067594 |
gtgtttgatgaaataaccaaccgtgatgatgtc |
15067562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University