View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4562_low_24 (Length: 236)

Name: NF4562_low_24
Description: NF4562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4562_low_24
NF4562_low_24
[»] chr1 (1 HSPs)
chr1 (16-218)||(43288892-43289094)


Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 218
Target Start/End: Complemental strand, 43289094 - 43288892
Alignment:
16 tatactttgcaataagacggagagattaagaaagaagggcatctttatattctttattacaatcagtgtcttgagtgaggaaaacacatagatcttttca 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43289094 tatactttgcaataagacggagagattaagaaagaagggcatctttatattctttattacaatcagtgtcttgagtgaggaaaacacatagatcttttca 43288995  T
116 ttattattatatgtattggaattagaatgctttttgaaatgaaaaatgtttattaaagaggtttttactcctttggtagttgagatggcttggaagatgc 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43288994 ttattattatatgtattggaattagaatgctttttgaaatgaaaaatgtttattaaagaggtttttactcctttggtagttgagatggcttggaagatgc 43288895  T
216 cat 218  Q
    |||    
43288894 cat 43288892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University