View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4566_high_7 (Length: 335)
Name: NF4566_high_7
Description: NF4566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4566_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 11 - 322
Target Start/End: Original strand, 44166628 - 44166939
Alignment:
| Q |
11 |
tttgtgtgaccacgtagagcacctatgactatcaaattaccattttcacctttttcagataccaatattgatctatcacatgcaccggaatacaaaaccg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44166628 |
tttgtgtgaccacgtagagcacctatgactatcaaattaccattttcacctttttcagataccaatattgatctatcacatgcaccggaatacaaaaccg |
44166727 |
T |
 |
| Q |
111 |
aaccgtcactgttaagagccaatgcattaatcccagatctgtgcttctccaaagtatcaactaacaaatgtttcttatctcctttatttttcttccaaac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44166728 |
aaccgtcactgttaagagccaatgcattaatcccagatctgtgcttctccaaagtatcaactaacaaatgtttcttatctcctttatttttcttccaaac |
44166827 |
T |
 |
| Q |
211 |
cttaannnnnnnatctgttgatccggtgtaaacatatccatcgttagaaactgtgattgcgtttattgcatcgtcgtgtgcgttttgcactgattccaaa |
310 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44166828 |
cttaatttttttatctgttgatccggtgtaaacatatccatcgttagaaactgtgattgcgtttattgcatcgtcgtgtgcgttttgcaatgattccaaa |
44166927 |
T |
 |
| Q |
311 |
catgtcaagtct |
322 |
Q |
| |
|
|||||||||||| |
|
|
| T |
44166928 |
catgtcaagtct |
44166939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University