View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4567_low_5 (Length: 281)
Name: NF4567_low_5
Description: NF4567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4567_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 68 - 271
Target Start/End: Complemental strand, 36679613 - 36679410
Alignment:
| Q |
68 |
tatagatgtgacttcagtcactttagttagtagttatttaacattggaagtcaaattttgggtttgtgaagattggtattttctagaatagatattcttg |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36679613 |
tatagatgtgacttcagtcactttagttagtagttatttaacattggaagtcaaattttgggtttgtgaagattgatattttctagaatagatattcttg |
36679514 |
T |
 |
| Q |
168 |
tgcacactgtattgatgtacaatgtaatttagacatggatagatattcttgaattcaaatcattgtgatagtttaatgtgctatgtgcatcatattatcc |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36679513 |
tgcacactgtattgatgtacaatgtaatttagacatgaatagatattcttgaattcaaatcattgtgatagtttaatgtgctatgtgcatcatattatcc |
36679414 |
T |
 |
| Q |
268 |
tatg |
271 |
Q |
| |
|
|||| |
|
|
| T |
36679413 |
tatg |
36679410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 15 - 71
Target Start/End: Complemental strand, 36679842 - 36679786
Alignment:
| Q |
15 |
actatcaattcttttttccatattcactcttattttcagttctagtcttaaaatata |
71 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36679842 |
actatcaattgttttttccatattcactcttattttcagttccagtcttaaaatata |
36679786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University