View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4568-Insertion-14 (Length: 264)
Name: NF4568-Insertion-14
Description: NF4568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4568-Insertion-14 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 7 - 264
Target Start/End: Original strand, 21507318 - 21507575
Alignment:
| Q |
7 |
atgtgatactttgtatcgcggaaaaatgtggttgatgcggtcgcaattgtgatcacaatattgttgttgtaaaacctctacaatttctgtcaactaataa |
106 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21507318 |
atgtgacactttgtatcgcggaaaaatgtggttgatgcggccgcaattgcgatcacaatattgttgttgtaaaacctctacaatttctgtctactaataa |
21507417 |
T |
|
| Q |
107 |
gtgctctaatctaaagtactttttcccttgtccttttctttttgtttgcagaggaaaaagaaaattaacgggttgcaaaagaaagaggaacttgaaaaag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21507418 |
gtgctctaatctaaagtactttttcccttgtccttttctttttgtttgcagaggaaaaagaaaattaacgggttgcaaaagaaagaggaacttgaaaaag |
21507517 |
T |
|
| Q |
207 |
aggtatttggattcatatatattttatggaaaaatttcataattaattactacatgag |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21507518 |
aggtatttggattcatatatattttatggaaaaatttcataattaattactacatgag |
21507575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University