View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4568-Insertion-16 (Length: 246)
Name: NF4568-Insertion-16
Description: NF4568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4568-Insertion-16 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 7 - 246
Target Start/End: Complemental strand, 47877076 - 47876836
Alignment:
| Q |
7 |
acgtttagtcacttttgctcaatcattttaatttatgatcctccaatgggatatttttatctttaaaaattcattcgtataattgataactaactaatct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47877076 |
acgtttagtcacttttgctcaatcattttaatttatgatcctccaatgacatatttttatctttaaaaattcattcgtataattgataactaactaatct |
47876977 |
T |
|
| Q |
107 |
agaagcatgcttgatgaacgcatggaatagttaaagaaccannnnnnnactagatacatagaactaga-tttgcacttagaaacattagttatgtcataa |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47876976 |
agaagcatgcttgatgaacgcatggaatagttaaagaaccatttttttactagatacatagaactagattttgcacttagaaacattagttatgtcataa |
47876877 |
T |
|
| Q |
206 |
ctcataagcatgcatgtgtcacgcactttgtggccttcttg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47876876 |
ctcataagcatgcatgtgtcacgcactttgtgtccttcttg |
47876836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University