View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4568-Insertion-22 (Length: 74)
Name: NF4568-Insertion-22
Description: NF4568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4568-Insertion-22 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 67; Significance: 2e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 2e-30
Query Start/End: Original strand, 8 - 74
Target Start/End: Complemental strand, 51413711 - 51413645
Alignment:
| Q |
8 |
gatccaaccatttctgcaacctcaattctctgtaaaacttttctatgaactcttccgccgcctggtc |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51413711 |
gatccaaccatttctgcaacctcaattctctgtaaaacttttctatgaactcttccgccgcctggtc |
51413645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.000000000000006
Query Start/End: Original strand, 8 - 68
Target Start/End: Complemental strand, 51418758 - 51418698
Alignment:
| Q |
8 |
gatccaaccatttctgcaacctcaattctctgtaaaacttttctatgaactcttccgccgc |
68 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| | ||||||||||| || ||||| |
|
|
| T |
51418758 |
gatccaaccatttctgcaacctcaactctctgtaaaacctctctatgaactcctctgccgc |
51418698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University