View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4568_high_17 (Length: 412)
Name: NF4568_high_17
Description: NF4568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4568_high_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 4e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 18 - 248
Target Start/End: Original strand, 9486132 - 9486360
Alignment:
| Q |
18 |
aataatttatcttttgcattggaatctgttgtgttttctactatactaatatggtttatagtattgttaatggcgagtttatggcccatttaccttatgc |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9486132 |
aataatctatcttttgcattggaatctgttgtgttttctactatactaatatggtttatagtattgttaatggcgagtttatggcccatttaccttatgc |
9486231 |
T |
|
| Q |
118 |
tccatttagtttatttagggtcatggatgaaagaaatgtgatnnnnnnnttcgagggttcagatttaaaaataaattaaatatgtannnnnnnnnnaata |
217 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||| |||||||||| |||||||||||||||||||| ||||| |||| |
|
|
| T |
9486232 |
tccatttagtttatttagggtcatgaatgaaagaaatatgataaaaaaattcgagggttgagatttaaaaataaattaaacatgta--ttttttttaata |
9486329 |
T |
|
| Q |
218 |
aaatataattttaaaagtcataacactttcc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9486330 |
aaatataattttaaaagtcataacactttcc |
9486360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 279 - 401
Target Start/End: Original strand, 9486403 - 9486525
Alignment:
| Q |
279 |
cttttcctctaccctctcatcaccttcaacgtccatcgatcgtaccgttgttcatcctgatcgcatccgttcatccctcaataacaagatcactcctctc |
378 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9486403 |
cttttcctctaccctctcatcaccttcaagatccatcgatcgtaccgtcgttcatcccgatcgcagccgttcatccctcaataacaagatcactcctctc |
9486502 |
T |
|
| Q |
379 |
ccgtcttcttttcattgcccctt |
401 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
9486503 |
ccgtcttcttttcattgcccctt |
9486525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 113 - 157
Target Start/End: Complemental strand, 33029602 - 33029558
Alignment:
| Q |
113 |
tatgctccatttagtttatttagggtcatggatgaaagaaatgtg |
157 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||| ||||| |
|
|
| T |
33029602 |
tatgctccatttagttcatttagggtattggatgaaagacatgtg |
33029558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University