View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4568_high_26 (Length: 339)
Name: NF4568_high_26
Description: NF4568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4568_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 304; Significance: 1e-171; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 7 - 326
Target Start/End: Complemental strand, 33399434 - 33399115
Alignment:
| Q |
7 |
gcatcagagataaattggtctcctgtaccctcacctacaccggcccctcaagcagcaccgccttcaaatgcaccatggaccgctccccgacggtccctgc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33399434 |
gcatcagagataaattggtctcctgtaccctcacctacaccggcccctcaagcagcaccaccttcaaatgcaccatggaccgctccccgccggtccctgc |
33399335 |
T |
 |
| Q |
107 |
tgcaaaagaagctattcaaaacgattcacaggaatctgataactgtttgagattggattagttcatgtgtcatgtttcaaagtggggctattttttctag |
206 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399334 |
tgcaaaagtagctattcaaaacgattcacaggaatctgataactgtttgagattggattagttcatgtgtcatgtttcaaagtggggctattttttctag |
33399235 |
T |
 |
| Q |
207 |
tgactaaaatcattaattatttattttctttatgttggtgaatttatttacacacataaataaaaagaatcacacgtttcctagtgatgatttcaaatct |
306 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399234 |
ttactaaaatcattaattatttattttctttatgttggtgaatttatttacacacataaataaaaagaatcacacgtttcctagtgatgatttcaaatct |
33399135 |
T |
 |
| Q |
307 |
gatcttatagctcttcctga |
326 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33399134 |
gatcttatagctcttcctga |
33399115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 8 - 163
Target Start/End: Complemental strand, 33395549 - 33395394
Alignment:
| Q |
8 |
catcagagataaattggtctcctgtaccctcacctacaccggcccctcaagcagcaccgccttcaaatgcaccatggaccgctccccgacggtccctgct |
107 |
Q |
| |
|
|||||||||||| ||||||||| || ||||||||||||||| ||||| ||| ||||||||||||||||||||||||||||||| |||| |||||||| || |
|
|
| T |
33395549 |
catcagagataacttggtctccggtgccctcacctacaccgtcccctgaagtagcaccgccttcaaatgcaccatggaccgctgcccgccggtccctact |
33395450 |
T |
 |
| Q |
108 |
gcaaaagaagctattcaaaacgattcacaggaatctgataactgtttgagattgga |
163 |
Q |
| |
|
|| ||||||||||||||||| ||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
33395449 |
gccaaagaagctattcaaaatgattcacagaaatttgatagctgtttgagattgga |
33395394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 33 - 84
Target Start/End: Complemental strand, 33395617 - 33395566
Alignment:
| Q |
33 |
accctcacctacaccggcccctcaagcagcaccgccttcaaatgcaccatgg |
84 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| ||||||||||||||||| |
|
|
| T |
33395617 |
accctcacctacaccggcccatgaagcagcaccgtcttcaaatgcaccatgg |
33395566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 33 - 84
Target Start/End: Complemental strand, 33399600 - 33399549
Alignment:
| Q |
33 |
accctcacctacaccggcccctcaagcagcaccgccttcaaatgcaccatgg |
84 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33399600 |
accctcacctgtgccggcccctgaagcagcaccgccttcaaatgcaccatgg |
33399549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 34 - 84
Target Start/End: Complemental strand, 33399500 - 33399450
Alignment:
| Q |
34 |
ccctcacctacaccggcccctcaagcagcaccgccttcaaatgcaccatgg |
84 |
Q |
| |
|
|||||||||||||| |||||| |||| ||||| |||||||||||||||||| |
|
|
| T |
33399500 |
ccctcacctacaccagcccctgaagccgcacctccttcaaatgcaccatgg |
33399450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University