View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4568_high_41 (Length: 267)
Name: NF4568_high_41
Description: NF4568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4568_high_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 91 - 248
Target Start/End: Original strand, 36192354 - 36192511
Alignment:
| Q |
91 |
attgttaacataagagactatataaacgacgtgttataatttaaatgatgtaattgttaaactattttgatagcactaactatttcaacgatcaatttgc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36192354 |
attgttaacataagagactatataaacgacgtgttataatttaaatgatgtaattgttaaactattttgatagcactaactatttcaacgatcaatttgc |
36192453 |
T |
 |
| Q |
191 |
ttatttgctctaaatttgtacctttactttcacgtccaaatcaacgttaagactttgt |
248 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
36192454 |
ttatttgctctaaatttttacctttactttcacgtccaaaacaacattaagactttgt |
36192511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 36191898 - 36191969
Alignment:
| Q |
1 |
ttttaagtttatgtgaaagacaaatgtttgcataacgtgtgacatcccaatctttatctgtattttgtttta |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||| | |||||||||||||||| ||||| |
|
|
| T |
36191898 |
ttttaagtttatgtgaaagacaaatgtttgcacaacgggtgacatcctagtctttatctgtattttttttta |
36191969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University