View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4568_high_44 (Length: 263)
Name: NF4568_high_44
Description: NF4568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4568_high_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 43584625 - 43584431
Alignment:
| Q |
1 |
aatatacagcttaggtctaaaccatagggtcaggcttttcaatcaattaaagtaatattatatattggtctcatattcttagtgcatgattggttatgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43584625 |
aatatacagcttaggtctaaaccatagggtcaggcttttcaatcaattaaagtaatattatatattggtctcatattcttagtgcatgattggttatgtg |
43584526 |
T |
 |
| Q |
101 |
atagcaaaaattgatttctactaaatttattcggtaaaattgattttatttaataatgaattgattataaaataatgatttaggtttgaatatatttgc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43584525 |
atagcaaaaattgatttctactaaatttatttagtaaaattgatttta-ttaataatgaattgattataa---aatgatttaggtttgaatatatttgc |
43584431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University