View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4568_high_54 (Length: 250)
Name: NF4568_high_54
Description: NF4568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4568_high_54 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 9988425 - 9988667
Alignment:
| Q |
1 |
ttgtttctctctttttaagtcaaaggggcattgcaaacaatatttgtaacattaatatttggctagcaccctgaannnnnnnggtatatatgtaacctat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
9988425 |
ttgtttctctctttttaagtcaaaggggcattgcaaacaatatttgtaacattaatatttggctagcaccctgaatttttttgctatatatgtaacctat |
9988524 |
T |
 |
| Q |
101 |
gaattgaagtagtagtagtagctaacaactnnnnnnngtgcttgcaataataaggagcaaaatagcatgttgaaaagtcttctttgtgatgattattatc |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9988525 |
gaattgaagtagtagtag---ctaacaactaaaaaaagtgcttgcaataataaggagcaaaatagcatgttgaaaagtcttctttgtgatgattattatc |
9988621 |
T |
 |
| Q |
201 |
cattttgcatgaaaaatattaatcctactataagcttttgtctgtgc |
247 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9988622 |
cattttgcatg-aaaatattaatcctactataagcttttgtctgtgc |
9988667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University