View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4568_high_71 (Length: 223)
Name: NF4568_high_71
Description: NF4568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4568_high_71 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 4 - 206
Target Start/End: Complemental strand, 35752619 - 35752415
Alignment:
| Q |
4 |
ttatcctcttctcaggccaataagcattggaaaggtttaacacttatttggcatgaaacaatttgagaaatttaggaagcgcataatagtatcatttttt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35752619 |
ttatcctcttctcaggccaataagcattggaaaggtttaacacttatttggcatgaaacaatttgaaaaatttaggaagcgcataatagtatcatttttt |
35752520 |
T |
 |
| Q |
104 |
ccttcaaaatccatgatggtagaagagattgcagaagccattaaagtaatctct---ttagagatggttacttggtagtaaaaaagggagccatgcttgt |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||||||| ||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
35752519 |
-cttcaaaatccatgacggtagaagagattgcagaagccattaaattaatctctagcttagagatggttacttgctaggaaaaaagggagccatgcttgt |
35752421 |
T |
 |
| Q |
201 |
attttg |
206 |
Q |
| |
|
|||||| |
|
|
| T |
35752420 |
attttg |
35752415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University