View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4568_high_78 (Length: 211)
Name: NF4568_high_78
Description: NF4568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4568_high_78 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 45729437 - 45729227
Alignment:
| Q |
1 |
ataggaggtttcatggagattatatttagtttttctggggcgatggagatggttgtcgatggtggaggatgggggtggagacggtggcgtttgatgtatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45729437 |
ataggaggtttcatggagattatatttagtttttctggggcgatggagatggttgtcaatggtggaggatggtggtggagacggtggcgtttgatgtatg |
45729338 |
T |
 |
| Q |
101 |
agattgcgaggggaatgagcatcaaggggaaaccggcggtttggaggaaggcggagagccagacacgttggccgccgtggatgaaatagagacgcattat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45729337 |
agattgcgaggggaatgagcatcaaggggaaaccggcggtttggaggaaggcggagagccagacacgttggccgccgtggatgaaatagagacgcattat |
45729238 |
T |
 |
| Q |
201 |
gaggggagcac |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
45729237 |
gaggggagcac |
45729227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 45725248 - 45725042
Alignment:
| Q |
1 |
ataggaggtttcatggagattatatttagtttttctggggcgatggagatggttgtcgatggtggaggatgggggtggagacggtggcgtttgatgtatg |
100 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||| ||||||||||||||| | |||||| ||| | | || || ||||| |||| |||||||| |
|
|
| T |
45725248 |
ataggtggtttcatggagattatattttgtttttctgaggcgatggagatggtgttggatggtaaaggtttgtggcggtgacggaaacgttggatgtatg |
45725149 |
T |
 |
| Q |
101 |
agattgcgaggggaatgagcatcaaggggaaaccggcggtttggaggaaggcggagagccagacacgttggccgccgtggatgaaatagagacgcattat |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45725148 |
agattgtgaggggaatgagcatcaaggggaaaccggcagtttccaggcaggcggagagccagacacgttggccgccgtggatgaaatagagacgcattat |
45725049 |
T |
 |
| Q |
201 |
gagggga |
207 |
Q |
| |
|
|||||| |
|
|
| T |
45725048 |
tagggga |
45725042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University