View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4568_high_79 (Length: 204)
Name: NF4568_high_79
Description: NF4568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4568_high_79 |
 | |
|
| [»] scaffold0662 (1 HSPs) |
| | |
|
| [»] scaffold0702 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0662 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: scaffold0662
Description:
Target: scaffold0662; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 15 - 189
Target Start/End: Original strand, 2323 - 2497
Alignment:
| Q |
15 |
caaagggtaccttgaagaatgatggtgatgcagagttgatnnnnnnngaggagcataagaaaccaatggagcattacaagaaaatgcaatgttgggttat |
114 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2323 |
caaagggtaccttgaagaatgatggtaatgcagagttgataaaaaaagaggagcataagaaaccaatggagcattacaagaaaatgcaatgttgggttat |
2422 |
T |
|
| Q |
115 |
attgaaaaagatgattgaaggaagagatgggtgggctctgaagcaccctctcgatctcaaggttttggagggttt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2423 |
attgaaaaagatgattgaaggaagagatgggtgggctctgaagcaccctctcgatctcaaggttttggagggttt |
2497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 15 - 189
Target Start/End: Complemental strand, 35172466 - 35172292
Alignment:
| Q |
15 |
caaagggtaccttgaagaatgatggtgatgcagagttgatnnnnnnngaggagcataagaaaccaatggagcattacaagaaaatgcaatgttgggttat |
114 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35172466 |
caaagggtaccttgaagaatgatggtaatgcagagttgataaaaaaagaggagcataagaaaccaatggagcattacaagaaaatgcaatgttgggttat |
35172367 |
T |
|
| Q |
115 |
attgaaaaagatgattgaaggaagagatgggtgggctctgaagcaccctctcgatctcaaggttttggagggttt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35172366 |
attgaaaaagatgattgaaggaagagatgggtgggctctgaagcaccctctcgatctcaaggttttggagggttt |
35172292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0702 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: scaffold0702
Description:
Target: scaffold0702; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 189
Target Start/End: Complemental strand, 2456 - 2285
Alignment:
| Q |
18 |
agggtaccttgaagaatgatggtgatgcagagttgatnnnnnnngaggagcataagaaaccaatggagcattacaagaaaatgcaatgttgggttatatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2456 |
agggtaccttgaagaatgatggtgatgcagagttgataaaaaaagtggagaataagaaaccaatggagcattacaagaaaatgcaatgttgggttatatt |
2357 |
T |
|
| Q |
118 |
gaaaaagatgattgaaggaagagatgggtgggctctgaagcaccctctcgatctcaaggttttggagggttt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2356 |
gaaaaagatgattgaaggaagagatgggtgggctctgaagcaccctctcgatctcaaggttttggagggttt |
2285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0702; HSP #2
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 62 - 189
Target Start/End: Complemental strand, 5726 - 5599
Alignment:
| Q |
62 |
gaggagcataagaaaccaatggagcattacaagaaaatgcaatgttgggttatattgaaaaagatgattgaaggaagagatgggtgggctctgaagcacc |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5726 |
gaggagcataagaaaccaatggagcattacaagaaaatgcaatgttgggttatattgaaaaagatgattgaaggaagagatgggtgggctctgaagcacc |
5627 |
T |
|
| Q |
162 |
ctctcgatctcaaggttttggagggttt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
5626 |
ctctcgatctcaaggttttggagggttt |
5599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University