View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4568_low_16 (Length: 424)
Name: NF4568_low_16
Description: NF4568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4568_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 381; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 381; E-Value: 0
Query Start/End: Original strand, 17 - 417
Target Start/End: Complemental strand, 27878578 - 27878178
Alignment:
| Q |
17 |
agaaacttgatgaggttcttgaaaagtatagtcttctttctgttgagaaggtgaagggtgttaaagggtgggaggttttggagaaaaaggaagatgtaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27878578 |
agaaacttgatgaggttcttgaaaagtacagtcttctttctgttgagaaggtgaagggtgttaaagggtgggaggttttggagaaaaaggaagatgtaga |
27878479 |
T |
|
| Q |
117 |
ggaaaattctgctgctgcttattggacaacgttggcaccaaacgtggaggattatagtggaagatttggtagatggattgctgcaggttcaggacaaatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27878478 |
ggaaaattctgctgctgcttattggacaacgttggcaccaaacgtggaggattatagtggaagatttggtagatggattgctgcaggttcaggacaaatg |
27878379 |
T |
|
| Q |
217 |
atcagaggaattttgtggtgtggtgatgttactgttgatagattgaaatggggtgatgatttcatgaagaagaggttgcaacctggttcttctcaatcac |
316 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27878378 |
atcagaggaattttgtggtgcggtgatgttactgttgatagattgaaatggggtgatgatttcatgaagaagaggttgcaacctggttcttctcaatcac |
27878279 |
T |
|
| Q |
317 |
agattagtccacttgccctgaatagtatgaaaaggtaagaaatttgaaaaatttctatcgctgaatgttttgtttcgtgttttatgcaattttgatgatg |
416 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27878278 |
agattagtccacttgccctgaatagtatgaaaaggtaagaaatttgaaaaaaatctatcactgaatgttttgtttcgtgttttatgcaattttgatgatg |
27878179 |
T |
|
| Q |
417 |
t |
417 |
Q |
| |
|
| |
|
|
| T |
27878178 |
t |
27878178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 226 - 289
Target Start/End: Complemental strand, 31870249 - 31870186
Alignment:
| Q |
226 |
attttgtggtgtggtgatgttactgttgatagattgaaatggggtgatgatttcatgaagaaga |
289 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||| |||| | |||||||||| |
|
|
| T |
31870249 |
attttgtggtgtggggatgttactgttgataggttgaaatggggtaatgagattatgaagaaga |
31870186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University