View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4568_low_32 (Length: 312)
Name: NF4568_low_32
Description: NF4568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4568_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 18 - 128
Target Start/End: Complemental strand, 11102344 - 11102233
Alignment:
| Q |
18 |
aataaaacaatcatcatcaagtttatctttgattaactgaaaaacaattaatcaacaatatat-aaaatatacatgtttaatgattaatttgatttggtt |
116 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |
|
|
| T |
11102344 |
aataaaacaattatcatcaagtttatctttgattaactgaaaaacaattaatcaacaatatataaaaatatacatgtttaatgattaatttgatttagtt |
11102245 |
T |
 |
| Q |
117 |
ataagttttttg |
128 |
Q |
| |
|
|||||||||||| |
|
|
| T |
11102244 |
ataagttttttg |
11102233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 136 - 223
Target Start/End: Complemental strand, 11101088 - 11101001
Alignment:
| Q |
136 |
ttaaatactgaacattttataatattttaaattaaagactgatttttgtaaatactaagaagatgatcaacatatattgctactaggc |
223 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11101088 |
ttaaataccgaacattttataatattttaaattaaagactgatttttgtaaatactaagaagatgatcaacatatattgctactaggc |
11101001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University