View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4568_low_37 (Length: 278)
Name: NF4568_low_37
Description: NF4568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4568_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 15 - 262
Target Start/End: Complemental strand, 18484721 - 18484475
Alignment:
| Q |
15 |
atcaccttgctgcatctggctgtgcacctgatgccttgcggtactgtcatccattccacacaaatccgactgttcccggacaacagaagaagtgacattt |
114 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18484721 |
atcaccttgctgcacctggctgtgcacctgatgccttgcggtactgtcatccattccacacaaatccgactgttcccggacaatagaagaagtgacattt |
18484622 |
T |
 |
| Q |
115 |
gcaagctaaggccgaacctgcatgatcagatccgtgtgtatccgcttgtgaatcatgaagttgggagggactcttttccagaatagaagcagataaattc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18484621 |
gcaagctaaggccgaacctgcatgatcagatccgtgtgtat-cgcttgtgaatcatgaagttgggagggactcttttccagaatagaagcagataaattc |
18484523 |
T |
 |
| Q |
215 |
agtatgggggattcatgcacgtcaatatgctctacagaacgtgaaagc |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18484522 |
agtatgggggattcatgcacgtcaatatgctatacagaacgtgaaagc |
18484475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University