View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4568_low_49 (Length: 254)

Name: NF4568_low_49
Description: NF4568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4568_low_49
NF4568_low_49
[»] chr1 (1 HSPs)
chr1 (51-254)||(6228057-6228260)


Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 51 - 254
Target Start/End: Complemental strand, 6228260 - 6228057
Alignment:
51 atagaaaagatagtattgtaatgggaaaatgactagagagaggagagatagatatgcatctaaccttagctagatatatggtcctcaatgctgcagaatc 150  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6228260 atagaaaagatagtattgtaatgggaaaatgactagagagaggagagatagatatgcatctaaccttagctagatatatggtcctcaatgctgcagaatc 6228161  T
151 aaatgnnnnnnnnnnnnntacataagtcacgcctagttaactcatattgaattggtggtgacttcagtccaaagtttatgtcattataaaccgacatgca 250  Q
    |||||             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6228160 aaatgaaaaattaaaaaatacataagtcacgcctagttaactcatattgaattggtggtgacttcagtccaaagtttatgtcattataaaccgacatgca 6228061  T
251 cctt 254  Q
    ||||    
6228060 cctt 6228057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University