View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4568_low_5 (Length: 501)
Name: NF4568_low_5
Description: NF4568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4568_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 2e-78; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 2e-78
Query Start/End: Original strand, 1 - 164
Target Start/End: Complemental strand, 30271247 - 30271083
Alignment:
| Q |
1 |
atatctaatttagtacagtatattgttaaattttgagacaagaaaactcaactaattgatagatagatgtatgaataaattataaatcaatcatctcttg |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30271247 |
atatctaatttagtacagtatattgataaattttgagacaagaaaactcaactaattgatagatagatatatgaataaattataaatcaatcatctcttg |
30271148 |
T |
 |
| Q |
101 |
agcattttgttgctcaaatattgaatcaccacttttattaaa-aaaatatcacaaaaagtagatg |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30271147 |
agcattttgttgctcaaatattgaatcaccacttttattaaaaaaaatatcacaaaaagtagatg |
30271083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 236 - 408
Target Start/End: Complemental strand, 30271045 - 30270873
Alignment:
| Q |
236 |
aacatatgaaactcactcacata----gagcttttcaggttagaactcagaacaccacaaatatttttaaccggataatttcaacgtctattatttgatc |
331 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| || |||| |||||| || ||| ||| |||||||||||||||||||||||| |
|
|
| T |
30271045 |
aacatatgaaactcactcacataagtagagcttttcaggttagaattccgaacgccacaatta-----aactggacaatttcaacgtctattatttgatc |
30270951 |
T |
 |
| Q |
332 |
ttagtcacatg-aaaaaagaggagaatggtacaaaatagtttttgcaggtgtcatgaagatgaagatgatgaatgttc |
408 |
Q |
| |
|
||||||||||| |||||||| || |||| ||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
30270950 |
ttagtcacatgcaaaaaagaagaaaatgatacaaaatagtttttgcaggtatcatggagatgaagatgatgaatgttc |
30270873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University