View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4568_low_52 (Length: 250)
Name: NF4568_low_52
Description: NF4568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4568_low_52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 13519729 - 13519507
Alignment:
| Q |
18 |
gtttgatgggatgcataagagagagtgtgtgtgatactccaataaaaatctatctcctgatgatagacaaccttgcctgcaagtctaatctgactctaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13519729 |
gtttgatgggatgcataagagagagtgtgtgtgatactccaataaaaatctatctcctgatgatagacaaccttgcctgcaagtctaatctgactctaac |
13519630 |
T |
 |
| Q |
118 |
ctttgcctttccctttcacttttaatttctctcattgccttgcagagggtaatttcttgacttttgcatacactttatttcctttattcttttcaccttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13519629 |
ctttgcctttccctttcacttttaatttctctcattgccttgcagagggtaatttcttgacttttgcatacactttatttcctttattcttttcaccttc |
13519530 |
T |
 |
| Q |
218 |
aatcttacttaaaacaacctatg |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
13519529 |
aatcttacttaaaacaacctatg |
13519507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 13609264 - 13609042
Alignment:
| Q |
18 |
gtttgatgggatgcataagagagagtgtgtgtgatactccaataaaaatctatctcctgatgatagacaaccttgcctgcaagtctaatctgactctaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13609264 |
gtttgatgggatgcataagagagagtgtgtgtgatactccaataaaaatctatctcctgatgatagacaaccttgcctgcaagtctaatctgactctaac |
13609165 |
T |
 |
| Q |
118 |
ctttgcctttccctttcacttttaatttctctcattgccttgcagagggtaatttcttgacttttgcatacactttatttcctttattcttttcaccttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13609164 |
ctttgcctttccctttcacttttaatttctctcattgccttgcagagggtaatttcttgacttttgcatacactttatttcctttattcttttcaccttc |
13609065 |
T |
 |
| Q |
218 |
aatcttacttaaaacaacctatg |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
13609064 |
aatcttacttaaaacaacctatg |
13609042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University