View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4568_low_74 (Length: 226)
Name: NF4568_low_74
Description: NF4568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4568_low_74 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 62 - 211
Target Start/End: Complemental strand, 34946622 - 34946473
Alignment:
| Q |
62 |
ggttattgtgaggatgaaaccagtgcgcagtgaaaatgacgaagcagattccattgttaagaaagtttccagcaattctttatcaatcaacggtcaggat |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34946622 |
ggttattgtgaggatgaaaccagtgcgcagtgaaaatgacgaagcagattccattgttaagaaagtttccagcaattctttatcaatcaacggtcaggat |
34946523 |
T |
 |
| Q |
162 |
ttcacctttgattccattgctcacattgatgctactcaggtatgttttct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34946522 |
ttcacctttgattccattgctcacattgatgctactcaggtatgatttct |
34946473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University