View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4568_low_74 (Length: 226)

Name: NF4568_low_74
Description: NF4568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4568_low_74
NF4568_low_74
[»] chr8 (1 HSPs)
chr8 (62-211)||(34946473-34946622)


Alignment Details
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 62 - 211
Target Start/End: Complemental strand, 34946622 - 34946473
Alignment:
62 ggttattgtgaggatgaaaccagtgcgcagtgaaaatgacgaagcagattccattgttaagaaagtttccagcaattctttatcaatcaacggtcaggat 161  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34946622 ggttattgtgaggatgaaaccagtgcgcagtgaaaatgacgaagcagattccattgttaagaaagtttccagcaattctttatcaatcaacggtcaggat 34946523  T
162 ttcacctttgattccattgctcacattgatgctactcaggtatgttttct 211  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||    
34946522 ttcacctttgattccattgctcacattgatgctactcaggtatgatttct 34946473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University