View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4568_low_77 (Length: 223)
Name: NF4568_low_77
Description: NF4568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4568_low_77 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 7 - 223
Target Start/End: Original strand, 9988148 - 9988364
Alignment:
| Q |
7 |
aaattgagtgacatctagaatagtagctaaacataatttagttaccaaaacactacttgtccnnnnnnncactacgtttgcagaatcctcaattattgtg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9988148 |
aaattgagtgacatctagaatagtagctaaacataatttagttaccaaaacactacttgtccaaaaaaacactacgtttgcagaatcctcaattattgtg |
9988247 |
T |
 |
| Q |
107 |
taaattttgaccttttgcatgccattgagcatgcatctctcttcatgtattaattggagagtcaatatcgacaaaataaagtaatcaccaaccaacctta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9988248 |
taaattttgaccttttgcatgccattgagcatgcatctctcttcatgtattaattggagagtcaatatcgacaaaataaagtaatcaccaaccaacctta |
9988347 |
T |
 |
| Q |
207 |
gaaatgttgcatgcaca |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
9988348 |
gaaatgttgcatgcaca |
9988364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University