View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4568_low_81 (Length: 213)
Name: NF4568_low_81
Description: NF4568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4568_low_81 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 43584266 - 43584071
Alignment:
| Q |
1 |
gtttgtcaattcaatcttgactgctccaaacacaggcttcatcataaacaatgacaaacaaatttgtcaactcaatccacttcacattgcacatgcatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43584266 |
gtttgtcaattcaatcttgactgctccaaacacaggcttcatcataaacaatgacaaacaaatttgtcaactcaatccacttcacattgcacatgcatag |
43584167 |
T |
 |
| Q |
101 |
tgtttgcattatgaacacacaataagaggtctacttgtagccatacattattagtttgcatgtctactaccttatttagtctctaaagccactttg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43584166 |
tgtttgcattatgaacacacaataagaggtctgcttgtagccatacattattagtttgcatgtctactaccttatttagtctctaaagccactttg |
43584071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 13 - 77
Target Start/End: Complemental strand, 43584315 - 43584251
Alignment:
| Q |
13 |
aatcttgactgctccaaacacaggcttcatcataaacaatgacaaacaaatttgtcaactcaatc |
77 |
Q |
| |
|
|||| ||| ||||||||||||| ||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
43584315 |
aatcctgaatgctccaaacacatacttcatcataaacaatgacaaacaagtttgtcaattcaatc |
43584251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University