View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4570-Insertion-3 (Length: 217)

Name: NF4570-Insertion-3
Description: NF4570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4570-Insertion-3
NF4570-Insertion-3
[»] chr7 (1 HSPs)
chr7 (25-213)||(36929907-36930113)


Alignment Details
Target: chr7 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 25 - 213
Target Start/End: Original strand, 36929907 - 36930113
Alignment:
25 caaataagaaggcatagattacaattgcttttaattgatgagttggagaacttgttaggttagcacttagcagtagcacttaaccagaataaat------ 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          
36929907 caaataagaaggcatagattacaattgcttttaattgatgagttggagaacttgttaggttagcacttagcagtagcacttaaccagaataaatatagat 36930006  T
119 ------------cctcgtgttttcgcacatgtatcactttaggcaaaatacatcctgggacccttttaatcgatctaatagtatcatactagtcctttta 206  Q
                ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
36930007 tactagtaaaatcctcgtgttttcgcacatgtatcactttaggcaaaatacatcctgcgacccttttaatcgatctaatagtatcatactagtcctttta 36930106  T
207 gttttcc 213  Q
    |||||||    
36930107 gttttcc 36930113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University