View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4570-Insertion-3 (Length: 217)
Name: NF4570-Insertion-3
Description: NF4570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4570-Insertion-3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 25 - 213
Target Start/End: Original strand, 36929907 - 36930113
Alignment:
| Q |
25 |
caaataagaaggcatagattacaattgcttttaattgatgagttggagaacttgttaggttagcacttagcagtagcacttaaccagaataaat------ |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36929907 |
caaataagaaggcatagattacaattgcttttaattgatgagttggagaacttgttaggttagcacttagcagtagcacttaaccagaataaatatagat |
36930006 |
T |
 |
| Q |
119 |
------------cctcgtgttttcgcacatgtatcactttaggcaaaatacatcctgggacccttttaatcgatctaatagtatcatactagtcctttta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36930007 |
tactagtaaaatcctcgtgttttcgcacatgtatcactttaggcaaaatacatcctgcgacccttttaatcgatctaatagtatcatactagtcctttta |
36930106 |
T |
 |
| Q |
207 |
gttttcc |
213 |
Q |
| |
|
||||||| |
|
|
| T |
36930107 |
gttttcc |
36930113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University