View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4570_high_1 (Length: 342)
Name: NF4570_high_1
Description: NF4570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4570_high_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 262; Significance: 1e-146; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 36 - 329
Target Start/End: Complemental strand, 33399408 - 33399115
Alignment:
| Q |
36 |
accctcacctgtgccggcccctgaagcagcaccgccttcaaatgcaccatggaccgctccccgacggtccctgctgcaaaagaagctattcaaaacgatt |
135 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33399408 |
accctcacctacaccggcccctcaagcagcaccaccttcaaatgcaccatggaccgctccccgccggtccctgctgcaaaagtagctattcaaaacgatt |
33399309 |
T |
|
| Q |
136 |
cacaggaatctgataactgtttgagattggattagttcatgtgtcatgtttcaaagtggggctattttttctagtgactaaaatcattaattatttattt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33399308 |
cacaggaatctgataactgtttgagattggattagttcatgtgtcatgtttcaaagtggggctattttttctagttactaaaatcattaattatttattt |
33399209 |
T |
|
| Q |
236 |
tctttatgttggtgaatttatttacacacataaataaaaagaatcacacgtttcctagtgatgatttcaaatctgatcttatagctcttcctga |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399208 |
tctttatgttggtgaatttatttacacacataaataaaaagaatcacacgtttcctagtgatgatttcaaatctgatcttatagctcttcctga |
33399115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 53 - 166
Target Start/End: Complemental strand, 33395507 - 33395394
Alignment:
| Q |
53 |
cccctgaagcagcaccgccttcaaatgcaccatggaccgctccccgacggtccctgctgcaaaagaagctattcaaaacgattcacaggaatctgataac |
152 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |||| |||||||| |||| ||||||||||||||||| ||||||||| ||| ||||| | |
|
|
| T |
33395507 |
cccctgaagtagcaccgccttcaaatgcaccatggaccgctgcccgccggtccctactgccaaagaagctattcaaaatgattcacagaaatttgatagc |
33395408 |
T |
|
| Q |
153 |
tgtttgagattgga |
166 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
33395407 |
tgtttgagattgga |
33395394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 13 - 87
Target Start/End: Complemental strand, 33399623 - 33399549
Alignment:
| Q |
13 |
tcctcaccttcagcctccccctcaccctcacctgtgccggcccctgaagcagcaccgccttcaaatgcaccatgg |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399623 |
tcctcaccttcagcctccccctcaccctcacctgtgccggcccctgaagcagcaccgccttcaaatgcaccatgg |
33399549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 14 - 87
Target Start/End: Complemental strand, 33395738 - 33395665
Alignment:
| Q |
14 |
cctcaccttcagcctccccctcaccctcacctgtgccggcccctgaagcagcaccgccttcaaatgcaccatgg |
87 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| | |||||||||||||| ||||||||||| |||||| |
|
|
| T |
33395738 |
cctcaccttcagcctccccgtcaccctcacctgtgccgactcctgaagcagcaccaccttcaaatgcgccatgg |
33395665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 31 - 87
Target Start/End: Complemental strand, 33395622 - 33395566
Alignment:
| Q |
31 |
ccctcaccctcacctgtgccggcccctgaagcagcaccgccttcaaatgcaccatgg |
87 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
33395622 |
ccctcaccctcacctacaccggcccatgaagcagcaccgtcttcaaatgcaccatgg |
33395566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 31 - 87
Target Start/End: Complemental strand, 33399506 - 33399450
Alignment:
| Q |
31 |
ccctcaccctcacctgtgccggcccctgaagcagcaccgccttcaaatgcaccatgg |
87 |
Q |
| |
|
||||| ||||||||| || ||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
33399506 |
ccctcgccctcacctacaccagcccctgaagccgcacctccttcaaatgcaccatgg |
33399450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University