View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4570_high_2 (Length: 360)
Name: NF4570_high_2
Description: NF4570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4570_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 6e-99; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 119 - 351
Target Start/End: Complemental strand, 28672769 - 28672544
Alignment:
| Q |
119 |
tcttccataattgacaaccatggtctcggtctcatgggtgctggtcaattttccgtaaaggtttatgcattggacactatcatgggcgaggttggattac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28672769 |
tcttccataattgacaaccatggtctcggtctcatgggtgctggtcaattttccgtaaaggtttatgcattagacactatcatgggcgaggttggattac |
28672670 |
T |
|
| Q |
219 |
aaggtcgaatctggtgggcatcctgggccgcacgggtgatgctcatttaccgttgctcgcagagccggccgagaaggattattggtatatggtggtaact |
318 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
28672669 |
agggtcgaatctggtgggcatcctgggccgcacgggtggtgctcatttaccattgctcgcagagccggctgagaaggattattggtatatggtagta--- |
28672573 |
T |
|
| Q |
319 |
gtcctagtgtcttgatgacattttcttctctgc |
351 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28672572 |
----tagtgtcttgatgacattttcttctctgc |
28672544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 28672912 - 28672837
Alignment:
| Q |
1 |
actttcaaccaacaggttgtgagttatgaacaaattgcatgcaatcttggatgtttgtttattcacaatcttggat |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28672912 |
actttcaaccaacaggttgtgagttatgaacaaattgcatgcaatcttggatgtttgtttattcacaatcttggat |
28672837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 66 - 113
Target Start/End: Complemental strand, 28672871 - 28672824
Alignment:
| Q |
66 |
caatcttggatgtttgtttattcacaatcttggattttagcttgcaac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28672871 |
caatcttggatgtttgtttattcacaatcttggattttagcttgcaac |
28672824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 16 - 48
Target Start/End: Complemental strand, 28638977 - 28638945
Alignment:
| Q |
16 |
gttgtgagttatgaacaaattgcatgcaatctt |
48 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
28638977 |
gttgtgacttatgaacaaattgcatgcaatctt |
28638945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University