View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4571-Insertion-5 (Length: 42)
Name: NF4571-Insertion-5
Description: NF4571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4571-Insertion-5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 31; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 38
Target Start/End: Complemental strand, 30274543 - 30274513
Alignment:
| Q |
8 |
atatttacgtgtcagtgtcattgtcgtatct |
38 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
30274543 |
atatttacgtgtcagtgtcattgtcgtatct |
30274513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University