View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4571_high_7 (Length: 276)
Name: NF4571_high_7
Description: NF4571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4571_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 272
Target Start/End: Original strand, 27112031 - 27112283
Alignment:
| Q |
19 |
ttaccatgcttgacggttagggtccccaagagcaggaactagaatggtactattaacaaattgaaatttgttcttcgcgcccaaggctttgcgcattgct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27112031 |
ttaccatgcttgacggttagggtccccaagagcaggaactaaaatggtactattaacaaattgaaatttgttcttcgcgcccaaggctttgcgcattgct |
27112130 |
T |
 |
| Q |
119 |
cgagttcatgccaagtagttagaaccatcaaagcttgggggaaacgattatagaattctgaccttcactaagattcacatagtattccaaatcatgattc |
218 |
Q |
| |
|
| ||| ||||| ||||||||||||||||| |||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27112131 |
caagtccatgctaagtagttagaaccatc-aagcttgggggaaacgattatagaattcggatcttcactaagattcacatagtattccaaatcatgattc |
27112229 |
T |
 |
| Q |
219 |
agtgcaggatcaataaatgcattactctaaatggtattggtacaagtgtctgtg |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27112230 |
agtgcaggatcaataaatgcattactctaaatggtattggtacaagtgtttgtg |
27112283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University