View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4571_low_12 (Length: 212)
Name: NF4571_low_12
Description: NF4571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4571_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 21 - 194
Target Start/End: Original strand, 46303573 - 46303746
Alignment:
| Q |
21 |
gcaatccatgtatgtcacctcttacttaacattctatgcatctctcataatttagattgaagtcgtgttcactgctcgaaataacactgacccatgtcgt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46303573 |
gcaatccatgtatgtcacctcttacttaacattctatgcatctctcatactttagattgaagtcgtgttcactgcttgaaataacactgacccatgtcgt |
46303672 |
T |
|
| Q |
121 |
tacatttaattgaatactttcatattctaaaaatttacttgtgtcgatgtgttagtgtctcgtttgtgcctttg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46303673 |
tacatttaattgaatactttcatattctaaaaatttacttgtgtcgatgtgttagtgtctcgtttgtgtctttg |
46303746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University