View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4571_low_12 (Length: 212)

Name: NF4571_low_12
Description: NF4571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4571_low_12
NF4571_low_12
[»] chr1 (1 HSPs)
chr1 (21-194)||(46303573-46303746)


Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 21 - 194
Target Start/End: Original strand, 46303573 - 46303746
Alignment:
21 gcaatccatgtatgtcacctcttacttaacattctatgcatctctcataatttagattgaagtcgtgttcactgctcgaaataacactgacccatgtcgt 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||    
46303573 gcaatccatgtatgtcacctcttacttaacattctatgcatctctcatactttagattgaagtcgtgttcactgcttgaaataacactgacccatgtcgt 46303672  T
121 tacatttaattgaatactttcatattctaaaaatttacttgtgtcgatgtgttagtgtctcgtttgtgcctttg 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
46303673 tacatttaattgaatactttcatattctaaaaatttacttgtgtcgatgtgttagtgtctcgtttgtgtctttg 46303746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University